Chap 7 pt 2

- Shows that Eukaryotic and bacterial genes are organized differently
Allows for alternative splicing (~95% human genes)
Allows for genetic recombination between exons; drives gene evolution

emoval of introns from a pre-mRNA
- Adenovirus genome example

consensus sequences at intron ends
•G/GU..................AG/G

Splicesome: complex containing variety of proteins and small nuclear riboproteins (snRNPs) “snurps”
•5’ and 3’ consensus splice sites; base pairing with snRNPs
•lariat intron excised

identify various SnRNPs

- A mature and intact mRNA will have 5’ cap, poly(A) tail and has been spliced
• Binding proteins recognize these modifications and move mRNA into cytoplasm

- a single gene can encode two or more related polypeptides
•~95% of multiexonic human genes are alt. spliced

- translation from nt language to aa language
• codons -- the nucleotide triplets that represent an aa
• codons are nonoverlapping

- 64 possible
- most aa have 2 or more codons
• 3 “stop” codons •built in safeguards
-- each aa’s codons are related
-- similar aa have similar codons (acidic, polar uncharged, hydrophobic, basic)
- Gentic code relates codon sequences in mRNA to amino acids in proteins

- decoding the codons

• codons -- the nucleotide triplets that represent an aa

- 73-93 nucleotides
•posttranscriptionally-modified unusal bases (e.g., pseudouridine, methylguanosine
•aa added to 3’ adenosine
•middle loop of 7 nts contains anticodon

- redundant
Several codons can specify a single aa •More than one tRNA per aa?
•Can single tRNA recognize more than one codon?
•Answer – Both can occur

- 61 codons encode for aa; but there are fewer than 61 tRNAs. Why?
• steric (structural) requirement between tRNA anticodon and mRNA codon is strict for first two positions, but flexible at third
• thus a single tRNA can recognize more than one codon

- aminoacyl-tRNA synthetase -- 20 different ones; enzyme covalently-links aa to correct tRNA
•single enzyme can recognize all tRNAs for that aa
•ATP required; primary energy requirement for peptide bond formation
•proofreading mechanism •aa has no role in targeting

AUG = Start codon; sets the reading frame
—CUAGUUACCAUGCUCCAGUCC—

- 10 initiation factors
• 43S complex binds to mRNA, when finds AUG, eIF2-GTP hydrolysis releases eIFs allowing large (60S) ribosome subunit to bind
• Kozak sequence -- additional nts containing AUG; help ribosome distinguish start from internal AUG; base pairs with rRNA

- eIF2 must be bound to GTP (not GDP) to bind to tRNA and initiate protein synthesis
•The phosphorylation of a serine on eIF2 makes in unable to exchange GDP for GTP and synthesis stops
•Done when cell has too many unfolded or denatured proteins

- there are 3
1. A -- aminoacyl
2. P -- peptidyl
3. E -- exit
- parts of ribosomes in contact with mRNA and tRNA lined with rRNAs

1. selection of aminoacyl-tRNA -- eEF1 α (EF-Tu in prokaryotes) delivers tRNA to A site; requires GTP hydrolysis to bind tightly
2. peptidyl transferase - - RNA portion of large subunit catalyzes transfer of aa; no energy required at this step
3. translocation -
- eEF2 GTP
hydrolysis
4. Deacylated tRNA released (when eEF1α GTP hydrolyzed)

EF-Tu = eEF1α
EF-G = eEF2
for each elongation cycle two GTPs hydrolyzed
each cycle lasts ~1/20 second

- Mutations can cause early termination
- termination codons can be formed by single nt changes from many codons
- base - pair subsitiution/ base-pair insertion or deletion

- selective destruction of mRNA with premature termination codons
- Exon-junction complex -- normally displaced by ribosome
- premature termination EJC remains on mRNA

In order to make enough protein fast enough - large subunit will come on and move down the RNA — when the first small subunit gets out of the way a new one comes to bind to AUG - Polyribosomes (many ribosomes copied at the same time)

fungi (euk) and bacteria (pro) — ribosomes a slightly different that there are inhibitors that work different on EUK and PRO ribosomes
antibiotics made by fungi — steps in protein synthesis that do not inhibit us but inhibits bacterial protein synthesis, therefore could be used in our boys
*** but does not affect eukaryote processes