Unit 4

Why does DNA polymerase need primers?

Remember DNA polymerase requires a _′ end to begin replication.
It cannot initiate without a primer - recall how lagging strands work!

This reaction specifically and exponentially amplifies DNA
-- A sequence between ______ is amplified, the rest of the template is not
-- For a 30 cycle reaction, each template will yield a billion products (2^30 = 1,073,741,824)
…as long as the primers are well-designed

What are the three steps of PCR?

___________ are synthetic oligonucleotides of SINGLE stranded DNA (ssDNA) that define the sequence amplified by PCR

Primers are always written _’ → _’ regardless of which DNA strand they anneal to

Primers are sometimes called “-mers” where “-mer” is preceded by the number of nucleotides (nts).
Ex: 5’ – ATGCTGTTG – 3’ might be called a “____-mer oligo”
123456789

PCR Primer Design Guidelines Ideal Single Primer

-- The ideal primer has a unique, high complexity sequence found in exactly ___ location on the template
-- Longer primers are more _______nique
-- Longer primers may ______ to themselves (or each other)

-- To balance complexity vs self-annealing:
Primer is ~20 nts long (range 18-30 nts)
Primer is composed of __% GC and __% AT
Primer does not have major secondary structures

PCR:

Looking at the coding sequence, primers are used to set the ____ and _____ boundaries for gene amplification.

In PCR:

The forward primer should be ________(upstream/downstream) of the gene and will be the same as the coding sequence.

In PCR:

The reverse primer should be _____________(upstream/downstream) of the gene and will be the reverse complement of the coding sequence.

In PCR:

Primers are complementary to the strand they anneal to, and identical to the opposite strand

The antisense strand is used as a template to create a copy of the _______ strand

The sense strand is used as a template to create a copy of the _________ strand

In PCR:

We can add any non-template ________ to our primers to be part of our product

This allows us to customize the ends of our PCR product and include ________ sites

You are designing a reverse primer using the SENSE strand of a gene.

How should you order the primer?
_' ----------- TAACATCGTGGACGGCAATC-----------_'

1) 5’ TAACATCGTGGACGGCAATC 3’
2) 3’ TAACATCGTGGACGGCAATC 5’
3) 5’ CTAACGGCAGGTGCTACAAT 3’
4) 5’ ATTGTAGCACCTGCCGTTAG 3’
5) 5’ GATTGCCGTCCACGATGTTA 3’

Tm is a biophysical term for __% melted (i.e. denatured, no longer base-pairing – note that circular DNA will still be intertwined, but will not be base pairing with itself).
We want binding to occur, so we set the __ lower than the Tm, but still high enough to maintain stringency.

To encourage annealing, the annealing temperature (Ta) during a PCR is typically set _°C lower than the Tm.

Melting temperature can be estimated by the following formula:
Tm= 4*(G+C) + 2*(A+T)

This formula is a rough estimate, other methods are also used
Be sure to check which is correct with the polymerase being used!


EXAMPLE: If you designed a 20-mer oligo, made of 50% GC and 50% AT content, what would be the primer’s Tm?

Setting up PCR

What are the reagents you need?

(1)
(2)
(3)
(4)
(5)
(6)

Troubleshooting PCR #1
You use the following PCR conditions to amplify a 1.3 kb product with primers that have an Tm of 65°C. You are using Vent polymerase which extends at a rate of 1 kb/min.

1) What should the annealing temperature (Ta) be?
2) How much time is needed for extension?
3) About how many cycles of PCR should we do?

If we amplified DNA through PCR, and then placed the product into Gel electrophoresis and saw NO BANDS, what could the possible explanations be?

1) The _______ did not bind
2) The time given for extension ______(was not/was) long enough

Could be other factors not mentioned here such as how much initial DNA was added (too little template DNA, not enough amplification cycles)

If we amplified DNA through PCR, and then placed the product into Gel electrophoresis and saw MULTIPLE BANDS, what could the possible explanations be?

1) Annealing temp too ____ will start to bind random places- lose specificity and fidelity

2) Template DNA: total amount of DNA is small- chance of its loss (degradation, clotting) and contamination

3)Too much DNA: packed DNA in the small space of test tube can lead to false priming and even poor DNA synthesis due to obstructed diffusion of large Taq pol

4) Too many cycles can cause an increase in “burden” DNA resulting in non-specific products

5) Primer concentration: rec conc. 0.1 and 1 uM of each primer too high can cause primers to form dimers (primer dimers) does not improve PCR amp also leads to non-specific binding and the creating of undesirable PCR products

Basically TOO MUCH PRIMER OR TOO MUCH TEMPLATE DNA can cause extra DNA to be caught in the product

How do you modify primers to add restriction sites?

Your insert will be created by PCR-amplifying the gene and adding restriction enzyme (RE) recognition sites to the _’ end of the primer.

You are cloning a gene by PCR and want to add a BamHI recognition site to the 3’ end of the gene. Which of the following describes the correct design to achieve this goal?

a. Add the BamHI site to the 5’ end of the forward primer.
b. Add the BamHI site to the 5’ end of the reverse primer.
c. Add the BamHI site to the 3’ end of the forward primer.
d. Add the BamHI site to the 3’ end of the reverse primer.

You are cloning a gene by PCR and want to add a EcoRI recognition site to the 5’ end of the gene. Which of the following describes the correct design to achieve this goal?

a. Add the EcoRI site to the 5’ end of the forward primer.
b. Add the EcoRI site to the 5’ end of the reverse primer.
c. Add the EcoRI site to the 3’ end of the forward primer.
d. Add the EcoRI site to the 3’ end of the reverse primer.

When digesting a plasmid for gene insertion, which pair(s) of enzymes would you pick and why?

(1) BamHI (cuts blunt ends) and EcoRI (cuts blunt ends)

(2) HindIII (cuts blunt ends) and TaqI (cuts 5' ends)

(3) NotI (cunts 3' ends) and EcoRV (cuts 3' ends)

(4) XbaI (cuts 5' ends) and SacI (cuts 3' ends)

Which of the following IS NOT A COMPONENT in a typical PCR reaction?

a. Magnesium

b. Reverse primer

c. Thermostable DNA polymerase

d. dNTPs

e. Restriction enzymes

f. Forward primer

g. Template DNA

Which of these components of the E-gel allows us to visualize the DNA using UV or blue light?

a. DNA ladder

b. SYBR Gold II

c. Ethidium bromide

d. Gel Red

Dr. S isolated pHLsec (5100 bp) using alkaline lysis and then performed a restriction endonuclease digest. Then she gave you her sample to visualize using gel electrophoresis. If Dr. S forgot to add the enzymes to the restriction digest, what would you expect to see on your gel if no enzymes were added?

a. One band at 5.1kb, or possibly multiple bands with the most prominent one being at 5.1 kb.

b. A single band at 5.1 kb.

c. Three bands: one faint band at 5.1 kb, one faint band above 5.1kb and one bright band below 5.1kb.

d. No bands

GO TO LAB 4 IN LABARCHIVES AND FILL OUT THE FIRST TWO TABLES

Let's say you digest your plasmid and the restriction endonucleases/enzymes you used made the ends compatible.

What are two problems you may face?

(1) The gene of interest can be inserted in the wrong __________ within the plasmid.
SOLUTION: Use _________ cloning, which requires the insert's cut ends and the plasmid's cut ends to only be compatible in ___ orientation

(2) The plasmid/vector closes back together (re-circularization)
SOLUTION: Use alkaline __________
-- This solution ONLY works on _____ ends
-- It cleaves the _' phosphate off of the blunt ends so they cannot reanneal