1Your friend says that her new phone will not turn on. You tell her the battery must be dead and that charging the phone should solve the problem.You are doing which of the following?
performing an experimental test of a hypothesis for why the phone won't turn on.
2A _ is a testable statement that proposes an explanation for an observation or even
Hypothesis
3A _ is a measurable or observable result or proposed result.
prediction
4A prediction is _ specific than a hypothesis.
more
You are part of a team studying the impacts of Medication X on blood sugar. Match the following statements with the term that correctly identifies them:
5Medication X does not lower blood sugar levels.
null hypothesis
You are part of a team studying the impacts of Medication X on blood sugar. Match the following statements with the term that correctly identifies them:
6Medication X lowers blood sugar levels.
hypothesis
You are part of a team studying the impacts of Medication X on blood sugar. Match the following statements with the term that correctly identifies them:
7Medication X lowers blood sugar levels more than the placebo.
prediction
8The number of unpaired electrons found in an atom is called its ____________.
valence
9Which is not a property of life?
breathes oxygen
10What is it called when two atoms share electrons to fill their valence shells?
a covalent bond
11What happens when one atom donates an electron to another atom?
It creates charges on the two atoms.
12What is the term for the attraction between oppositely charged atoms?
an ionic bond
13The bonds that are within a water molecule are known as ____________.
polar covalent bonds
14What gives an organic molecule its overall shape by providing a sort of skeleton?
Carbon atoms
15What changes the properties and behavior of an organic molecule?
Functional groups
16What are monomers?
Monomers are the building blocks of polymers, characterized by their repetitive structure,
17What are Polymers?
polymers are composed of multiple monomers linked together.
18Which of the following characteristics accurately describes lipids?
Lipids are a diverse group of biomolecules that are insoluble in water but soluble in nonpolar solvents.
19A protein is composed of specific kinds of
amino acids
20How do phospholipids interact with water molecules?
The polar heads interact with water; the non polar tails do not
21Which of the following statements best describes the basic function of nucleic acids?
They store and transmit genetic information, guiding the synthesis of proteins.
22Which of the following statements accurately describes the roles of macromolecules in cellular processes?
Nucleic acids store and transmit genetic information, while proteins perform diverse functions such as catalysis, structural support, and regulation.
23Which of the following options accurately describes the relationship between monomers and polymers in the context of macromolecules
:Monomers are the individual units that make up polymers, and are typically much smaller than polymers
24What kind of chemical reaction is a reaction where H2O is added?
Hydrolysis
25What kind of chemical reaction is a reaction where H2O is removed?
Dehydration
26What kind of macromolecule contains a chain of Carbon with hydrogen attached and an OH and O attatched at one end.
lipid
27What does it mean when a molecule is amphipathic?
it means they have polar and non polar parts
28Where are amphipathic molecules found?
cell membrane
29How are proteins used by the body?
structure, transport, immune defense, hormones
30If you were looking through a microscope and identifying a mystery cell, which of the following organelles would lead you to conclude that it was a plant cell?
central vacuole
31Which of the following statements accurately distinguishes prokaryotic cells from eukaryotic cells?
Prokaryotic cells are generally smaller and lack membrane-bound organelles, unlike eukaryotic cells.
32When looking at a cell membrane, where can we find carbohydrates?
The exterior surface
33In which direction does water typically move during osmosis?
From a hypotonic solution to a hypertonic solution.
34In the image below, there is a cell membrane that does not have any protein channels. The cell contains 1.4 M glucose and 1.5 M NaCl and is placed in a solution that contains 1.8 M glucose and 1.4 M NaCl. What will happen to the cell?
It will shrink
35The cell has now been modified so that the plasma membrane is also composed of protein channel that facilitates the transport of ions across the cell membrane. Describe what will happen to the cell when it is again placed in a 1.8 M glucose and 1. 4 M NaCl solution.
It will shrink
36A researcher is studying the structure and function of cell membranes. In one experiment, they selectively removed all phospholipids from a group of cells. What would be the most likely consequence of this removal?
The cells would no longer be able to control the movement of substances in and out of the cell.
37A cell biologist is investigating the transport of ions across a cell membrane. They observe that certain ions are moving rapidly through specific protein channels in the membrane, from an area of higher concentration to an area of lower concentration. This process is best described as
:facilitated diffusion
38Insulin is a hormone protein produced in the pancreas. The pancreatic cells secrete (release) these proteins so they can regulate the amount of glucose in the blood. You immediately realize that this protein is synthesized in the ___________ the organelle responsible for producing proteins that are exported from the cell.
Rough ER
39This organelle is responsible for synthesis of lipids.
Smooth ER
40Mutations in CFAP43 and CFAP44 genes (cilia and flagella associated proteins) have been shown to result in male infertility in humans and also in a parasite called Trypanosome. Which of the following cytoskeletal elements will be involved in this mutation?
microtubules
41_____ is a tentative statement that is testable and it doesn't have to be right
A hypothesis
A new drug has been developed to increase the number of red blood cells in patients who have anemia called PoetinX. It is now going to go through a drug trial in which patients either get injections of PoetinX or saline (placebo). Match the following terms with the correct components of the drug trial.
42What is the independent variable in the PoetinX drug trial?
Drug group (PoetinX or saline)
A new drug has been developed to increase the number of red blood cells in patients who have anemia called PoetinX. It is now going to go through a drug trial in which patients either get injections of PoetinX or saline (placebo). Match the following terms with the correct components of the drug trial.
43What is the dependent variable in the PoetinX drug trial?
Red blood cell count
A new drug has been developed to increase the number of red blood cells in patients who have anemia called PoetinX. It is now going to go through a drug trial in which patients either get injections of PoetinX or saline (placebo). Match the following terms with the correct components of the drug trial.
44What is the hypothesis of the PoetinX drug trial?
PoetinX increases red blood cell count
45Variable that is manipulated
Independent variable
46Variable that is measured
Dependent variable
47Specifies what should be observed when the hypothesis being tested is not correct
Null hypothesis
48Checks for factors other than the one being tested that might influence the outcome
Control variable
49Which of the following correctly reflects the process of science?
Observation --> question --> hypothesis formulation --> experiment --> support or refute hypothesis
50__________ are well-founded explanations supported by a wide body of evidence. Usually, hundreds of years of evidence support these. ________ are well-thought-out guesses based on observations that can be tested.
Theories; hypotheses
51if the hydrogen bonds on H2O/water molecule are facing the atom in the middle, how would you describe the atom in the middle?
This ion has a negative charge
52Ammonia is a molecule made up of 1 nitrogen (N) and 3 hydrogens (H). Nitrogen is more electronegative than hydrogen, and electrons are shared. How would you describe this molecule in relation to water?
Ammonia is hydrophilic because it is a polar covalent molecule.
53What happens to a carboxyl group in water?
It is charged and acts as an acid, losing a proton.
54Cysteine, an amino acid, is shown above. It has multiple functional groups. Which functional group is circled? (H-S)
A sulfhydryl
55Which molecules are not soluble in water?
Nonpolar molecules
56The unique properties of water occur because it is a(n)______ molecule, which has the ability to form _______with other water molecules.
polar; hydrogen bonds
57A nutritionist is counseling a client on the importance of including unsaturated fatty acids in their diet for heart health. The client asks, "Where can I find unsaturated fatty acids in my diet?" Which of the following food sources would be the best recommendation for the nutritionist to suggest, considering the client's goal of incorporating unsaturated fatty acids?
Salmon and walnuts
58Biomolecules such as amino acids, nucleotides, and monosaccharides will form larger molecules via __________ reactions.
dehydration
59You have identified a novel condition that makes it very challenging for people to fight disease. You believe that this is caused because the body is unable to build antibodies to aid in immune response. What type of biomolecule do you think is affected by this disease?
proteins
60Why might an athlete "carb-load", meaning they eat a large number of carbohydrates, before an event?
To supply their cells with quick energy
61Water is a polar molecule because...
Oxygen and hydrogen have different electronegativities, causing electrons to be shared unequally.
In order to be classified as an amino acid, an amino acid MUST have which of the following components? Check all that apply.
a carboxyl
a hydrogen atom
a central carbon
an amino
a carbonyl
a distinctive R group
62a hydroxyl
a carboxyl, a hydrogen atom, a central carbon, and an amino group.
63Water is absolutely essential to farmers as they consider crop health. Which property of water is most directly responsible for helping water move from roots to leaves in tall plants?
Cohesion and adhesion
64Dr. Townsend, a pediatrician, explained that in Congenital Disorder of Glycosylation type 1a, some proteins are not properly modified with sugars. Why is this modification important?
The sugars contribute to the protein's overall structure. A protein's structure determines its function.
65In order to form a polymer from monomers, __ occurs
dehydration
66Newly formed bonds from dehydration results in _.
the loss of a water molecule
67_ occurs in order to break polymer into monomers.
hydrolysis
68The broken bonds from hydrolysis is due to _.
the addition of a water molecule
69What are the two main types of secondary structures in proteins?
α-helix and β-pleated sheet
70What type of bonds hold the α-helix and β-pleated sheet structures in place?
Hydrogen bonds
71What level of protein structure do α-helices and β-pleated sheets represent?
Secondary structure
72When you put meat in brine (water with salt), the meat changes color because the proteins change conformation (as they change conformation, water is able to enter between the proteins making a more tender cooked meat). This change in the conformation of the protein is called
protein denaturation
73if we change the order of amino acids in a protein, what will be the result?
It will alter its three-dimensional shape, which in turn can significantly change or completely lose its function/serve a different function.
74How does temperature and concentration affect reaction rates?
An increase in temperature and and increase in concentration can both increase reaction rates.
75Proteins found in our bodies are surrounded by water. For amino acids that are non-polar (hydrophobic), where you expect them to be located in the protein?
Buried inside of the protein
76What temperature do you think human metabolic enzymes function optimally?
37 degrees Celsius/ 98.6 degrees fahrenheit
77When polypeptide chains are being built up, what kind of reaction(s) occur(s)?
condensation reactions
78If the alpha helix structure is disrupted, which level of protein structure is impacted?
secondary
79This figure is an example of:(Coenzyme bonding to a different location than the active site where the substrate bonds.)
Allosteric inhibition.
80What kind of enzyme regulation happens where an inhibitor binds to an allosteric site (a site other than the active site) on the enzyme
Non-competitive inhibition.
81What kind of enzyme regulation happens when the final product of a metabolic pathway binds to an earlier enzyme, slowing or stopping its own production
Feedback inhibition.
Which group(s) of organisms is/are primarily responsible for performing photosynthesis? (Mark all that apply)
archaea
plants
cyanobacteria
algae
fungi
82animals
plants
cyanobacteria
algae
83Which of the following correctly describes the relationship between the light-dependent and light-independent reactions of photosynthesis?
Light-independent reactions require the products of light-dependent reactions to function.
84What type of energy is converted into chemical energy during photosynthesis?
light
85In photosynthesis, what is the initial source of electrons for the chloroplast electron transport chain?
water
86During which stage of the Calvin cycle is ATP and NADPH used to convert 3-PGA into glyceraldehyde 3-phosphate (G3P)?
Reduction
87You are looking at a cell under the microscope and trying to determine if it is a plant or an animal cell. Which of the following could help you determine what type of cell it is?
You would look for the presence or absence of chloroplasts. If the cell contains chloroplasts that would indicate it is a plant cell, because eukaryotic plants can perform photosynthesis.
88A patient comes to a clinic with liver problems. He drinks alcohol very frequently and when the analysis of his liver is done, it is found that his liver cannot detoxify properly the alcohol and drugs that the patient takes. You realize immediately that the patient has a defect in the following organelle
:smooth endoplasmic reticulum
89You are a researcher investigating a crippling disease. When taking cells from patients with this disease, you detect high levels of proteins that function optimally under acidic conditions. These proteins are degrading other proteins in the cell. Knowing this information, you should look at the genes encoding for which part of the cell first?
the lysosomal membranes
90Individuals with a condition known as exercise intolerance suffer extreme fatigue from minimal exertion. Defects in which of the following organelles are most likely responsible for this condition?
mitochondria
Which of the following steps in the endomembrane system is out of order and why?
1. Genetic information (mRNA) coding for proteins leaves the nucleus
2. Proteins are translated in the rough endoplasmic reticulum
3. The proteins are transported in a vesicle
4. Proteins are transported to the cell's lysosomes
5. The proteins are modified in the Golgi apparatus
916. The proteins are sent to the plasma membrane
4 - Because the lysosome can only be a final destination
92You are studying two cell membranes exclusively made of different types of phospholipids that are all the same size. Membrane A appears to be much more fluid than membrane B. What does this tell you about the composition of membrane A?
Membrane A is likely composed of more unsaturated fatty acid tails than membrane B.
93Epidermis bullosa is a human disorder characterized by the formation of blisters in response to mild physical touching. Children with this conditions are also called the "butterfly skin" children. It is caused by a mutation in keratin that joins together desmosomes. This keratin is part of the cytoskeletal proteins that are NOT involved in movement, only in structure. The proteins belong to the...
intermediate filaments
94Water diffuses very slowly through phospholipid bilayers that don't contain transport proteins. However, in our kidneys, water is moved very rapidly in the nephron where 60-70% of the filtered solutes and water are reabsorbed into the blood. The rapid and large transport of water from high concentration to low concentration in the kidneys is done by a protein called aquaporin. This process is called
facilitated diffusion
95A cell with inactive protein channels in its cell membrane has been added to a solution that contains .5 M glucose and 3.0 M NaCl. The cell contains 1.3 M glucose and 2.0 M NaCl. Keeping in mind that NaCl will dissociate in water, the cell was placed in a ___ solution (before any movement) and the cell will ___. The protein channels are then activated. These protein channels ONLY facilitate the transport of large, polar substances (nothing else). After the protein channels have been activated, the cell will continue to ___ until the equilibrium of water has been reached.
hypertonic; shrink; shrink
96The cytoplasm of a red blood cell contains 0.9 % sodium chloride. You put this cell into pure water (0% sodium chloride). What will happen to the cell?
The cell will burst because this is a hypotonic solution
97What type of permeability do plasma membranes have?
semi-permeable
98Plasma membranes are most permeable to which type of molecules?
small nonpolar molecules
99Plasma membranes are least permeable to which type of molecules?
small ions
100Early investigators thought the oxygen produced by photosynthetic plants came from carbon dioxide. In fact, it comes from __________.
water
101What event accompanies energy absorption by chlorophyll (or other pigment molecules of the antenna complex)?
the energy is transferred to an electron
102How might an enzyme inhibitor slow down the action of an enzyme without binding to the active site?
It could bind the enzyme at an allosteric site, changing the enzyme's shape.
103In the chloroplasts of plant cells, the absorption of light energy and the movement of electrons along an electron transport chain occurs in the _.
thylakoid membranes
104the synthesis of carbohydrates takes place in the _.
stroma
105Why are there several structurally different pigments in the reaction centers of photosystems?
This arrangement enables the plant to absorb light energy of a variety of wavelengths.
106Anabolic pathways __________.
require an input of energy to build polymers from monomers
107Catabolic pathways ______.
break down large molecules into smaller ones and release energy in the process.
108The most common polymer below that is used as a source of energy is
:starch
109Pyruvate carboxylase (PC) is an important metabolic enzyme in cellular respiration. PC catalyzes the conversion of pyruvate (a small sugar) to oxaloacetate (a key intermediate molecule) in the citric acid cycle. Mg2+ (a magnesium ion) is an essential metal ion for PC, meaning it needs Mg2+ in order to function. Mg2+ would be considered a what for this enzyme?
cofactor
110What type of processes do biomolecules like amino acids, nucleotides, and monosaccharides undergo to form larger molecules?
anabolic
111What type of reaction is required for biomolecules to form larger molecules?
dehydration
112Do anabolic processes require or release energy?
require
113Which reaction line (solid or dashed) represents the chemical reaction in the presence of an enzyme?
dashed
114Which level of protein structure does this statement describe? "There are extensive ionic interactions between positively charged R groups and negatively charged R groups on a single polypeptide."
tertiary
115Amylase is an enzyme found in saliva and pancreatic juice in humans. It helps to break down carbohydrates, specifically by hydrolyzing starch into smaller sugars. If there was an allosteric inhibitor on the amylase, what could result?
Decreased breakdown of carbohydrates.
Use the following polypeptide to answer the question:
Gly-Ala-Leu-Val-Ser-Thr
116Say there was a mutation that changed the third (bolded) residue to Arginine. How could this impact the resulting protein's structure?
The third residue could now be found on the outside of the 3D structure due to Arginine's hydrophilic properties.
117A group of scientists is studying the impact of water properties on aquatic ecosystems. They observed that a particular lake maintains a relatively stable temperature, and organisms in the lake can thrive in cold conditions. Additionally, the lake supports a diverse range of life forms. What property of water is most likely contributing to these observations?
low density as a solid
118In order to start the light reaction of photosynthesis, electrons must be dropped off at ________ .
Photosystem II
119Organ transplant patients need to take immunosuppressant medication because their immune system may recognize the new organ as "foreign." This response is triggered by specific structures found in cell membranes. If the immune system detects that these structures on the transplanted organ are different from the recipient's own cells, it will attack the organ. What membrane structure is being described?
glycoproteins
120Salivary amylase is an enzyme in human saliva that begins the breakdown of starch into simpler sugars in the mouth. Its activity depends on its three-dimensional structure and the environment in which it functions. In a dental context, which of the following scenarios would most likely reduce the activity of salivary amylase and increase the risk of dental caries?
Having a highly acidic oral environment due to frequent consumption of sugary drinks, which partially denatures salivary amylase.
121What is a key characteristic of fermentation?
It regenerates NAD+ for glycolysis
122During which stage of cellular respiration is carbon dioxide primarily produced as a waste product?
Citric Acid Cycle
123Which of the following correctly lists the stages of cellular respiration in chronological order?
Glycolysis, Krebs Cycle, Electron Transport Chain
124In which organisms does cellular respiration occur?
In all types of cellular organisms
125Which of the following best describes the overall purpose of cellular respiration?
To release energy from glucose and use it to produce ATP.
126The first electron acceptor in cellular respiration is
NAD+
Which of the following statements are TRUE regarding the citric acid cycle?
the citric acid cycle is also known as the Krebs cycle
ATP and CO2 are produced during the citric acid cycle
2 different electron carriers are used during the citric acid cycle
127the citric acid cycle takes place in the mitochondria
all of the above
128Assume that a eukaryotic cell has abundant glucose and oxygen but needs ATP. The proton gradient in mitochondria of this cell will be generated by ______ and used primarily for ___
the electron transport chain; ATP synthesis
129In the process of cellular respiration, glucose is oxidized to produce energy in the form of ATP. During this redox reaction, what happens to the electrons originally found in glucose?
Electrons are gained by oxygen molecules to form water.
130A drug that targets the citric acid cycle is being developed to fight cancer. Which of the following actions would most likely stop cancer cells from growing?
Inhibiting the production of NADH and FADH2
131Fermentation is an alternative energy-producing process that occurs in the absence of oxygen. Which of the following is NOT a common product of fermentation?
Acetyl-CoA
132During cellular respiration, high-energy electrons are generated and used to drive the synthesis of ATP. Which of the following statements accurately describes the relationship between these high-energy electrons, energy potential, and ATP synthesis?
High-energy electrons have a high energy potential and are used to create a proton gradient that powers ATP synthesis.
133"The sequence of amino acids" describes which level of protein structure?
Primary structure
134In the central dogma of molecular biology, what is the sequence of information flow from DNA to a functional product like a protein?
DNA → RNA → Protein
135What is the function of RNA polymerase?
Unwind the double helix and add nucleotides to a growing RNA str
Which of the following statements are TRUE regarding the genetic code? Check all the apply
some codons overlap each other
no amino acids are coded by more than one codon
multiple codons coding for one amino acid usually vary in all three bases
136most amino acids are coded by more than one codon
most amino acids are coded by more than one codon
137An anticodon would be found on which of the following types of RNA?
tRNA
If the following DNA molecule were transcribed, which mRNAs might be produced? *Remember which direction RNA polymerase "reads" and "builds". *
3'-ATC GGC AGG ACC TTA AAT-5'
1385'-TAG CCG TCC TGG AAT TTA-3'
D and C
139Which type of organism performs mRNA processing after transcription?
Eukaryotes
You are looking for the mRNA template that codes for these amino acids
Met Lys Thr Ile Ile Ala Leu Ser Tyr Ile...
RNA #1: 5' GA AUG UAG CUC AAA GCA AUGAUAGUCUUCAUGGUUA 3'
RNA #2: 5' UAACC AUG AAG ACU AUC AUU GCUUUGAGCUACAUUC 3'
140Which mRNA strand is the correct strand?
RNA #2
141What is the role of the promoter in transcription?
It initiates transcription by binding RNA polymerase
142What is the role of the start codon in translation?
to signal the ribosomal subunits to come together at the beginning of the mRNA sequence to initiate protein synthesis
143What is the primary function of tRNA in translation?
tRNA acts as a crucial adaptor molecule that bridges the gap between the genetic code in mRNA (codons) and the amino acid sequence of a polypeptide chain. It delivers specific amino acids to the ribosome in the correct order.
144How does a tRNA molecule ensure the correct amino acid is added to the polypeptide chain?
Each tRNA has an anticodon that is complementary to a specific mRNA codon. The tRNA is "charged" by an enzyme (aminoacyl-tRNA synthetase) with the correct, specific amino acid corresponding to that codon, ensuring accurate decoding of the genetic message.
145Describe how tRNA interacts with the ribosome during polypeptide synthesis.
tRNA molecules move through the ribosome's A, P, and E sites. A new tRNA enters the A site, the amino acid is added to the chain at the P site via a peptide bond, and the empty tRNA exits from the E site, facilitating the sequential, codon-by-codon assembly of the protein.
146Clostridium perfingensis a bacterium commonly found in wastewater that uses nitrate, an inorganic molecule, instead of oxygen as the final electron acceptor. This process is called ...
Anaerobic respiration, but not fermentation
147Which of the following sequences correctly represents the flow of energy through living systems?
light⟶photosynthesis ⟶ carbohydrate ⟶ cellular respiration ⟶ ATP ⟶ heat
148Following the citric acid cycle, but before the electron transport chain and oxidative phosphorylation, most of the energy from the original glucose molecule is found in
:NADH and FADH2
149Atractyloside is a poison that inhibits the transport of ADP from the cytosol across the mitochondrial membranes and into the mitochondrial matrix. The direct effect of this drug is to stop ATP synthesis because
:ADP is a necessary substrate for ATP to be catalyzed by ATP synthase.
150A specific type of poison functions because it allows hydrogen ions to cross a lipid bilayer without requiring the use of a transport protein. Which of the following explains how this poison would affect the function of the mitochondria?
The proton gradient formed by the electron transport chain would just travel across the membrane instead of through ATP synthase, leading to loss of ATP formation even though the ETC was still functioning.
151Complete breakdown of glucose to CO2 involves two different mechanisms for synthesizing ATP: oxidative phosphorylation and substrate-level phosphorylation. Which is true of substrate-level phosphorylation?
Only a small amount of ATP made during cellular respiration is generated through substrate-level phosphorylation.
Based on the table, which cellular respiration process is likely not functioning as it normally would in this patient?
Metabolite: Patient levels compared to average levels
glucose: normal
pyruvate: normal
acetyl-CoA: normal
lactate: normal
NAD+: higher
FAD: higher
NADH: lower
152FADH2: lower
citric acid cycle
153Which one of the following statements best represents the relationship between cellular respiration and photosynthesis?
Photosynthesis stores energy in organic molecules, while respiration releases it.
154What determines the start site and direction of transcription?
promoter region
155Which does epigenetic gene regulation NOT rely on?
concurrent transcription and translation
156Many antibiotics inhibit bacterial protein synthesis. For example, tetracycline blocks the A site on the bacterial ribosome. What specific effect would you expect each of these Tetracycline to have on protein synthesis? Meaning, what is the significance of the A site?
tRNA binding to the ribosome
157Another antibiotic, Chloramphenicol, blocks the P site, which would directly affect
:Growth of the protein chain
Based on this DNA template strand that reads:
3'-AGTCCTGACGGTACCACATTTATTGTCATCATGTACTCCGGACTTG-5'
158What is the pre-mRNA (unprocessed) sequence? Introns are indicated by the boldednderlined portion. Transcribe the DNA strand to the very end (a transcription termination region has not been indicated).
5' -UCAGGACUGCCAUGGUGUAAAUAACAGUAGUACAUGAGGCCUGAAC-3'
Given the DNA template strand from the previous question:
3'-AGTCCTGACGGTACCACATTTATTGTCATCATGTACTCCGGACTTG-5'
159What is the resulting mRNA sequence after the spliceosomes perform their role (mature mRNA)?
5' CAP-UCAGGACUGCCAUGGUAAUAACACAUGAGGCCUGAAC- AAAAAA 3'
Given the DNA template sequence from the previous question:
3'-AGTCCTGACGGTACCACATTTATTGTCATCATGTACTCCGGACTTG-5'
160What is the amino acid sequence? (The stop codon is not listed)
Met-Val-Ile-Thr-His-Glu-Ala
Now consider a mutation that was made to the DNA template strand:
3'-AGTCCTGACGGTACCACATTTATGTCATCATGTACTCCGGACTTG-5'
161What type of mutation occurred? (Hint - transcribe and translate this sequence and compare to the sequence above.)
frameshift
162Transcription is the process
Where RNA is made using a DNA sequence as a template.
mRNA vaccines for COVID work by inserting an mRNA molecule into your body, which your cells then read as instructions to produce certain viral proteins (specifically, the SARS-COV-2 spike protein). Your immune cells then recognize this viral protein because it is foreign—your human DNA doesn't contain any instructions on how to make this protein, so it has never been made before.
When your immune cells recognize the protein, they make antibodies against it. The antibodies are, effectively, antibodies against the SARS-COV-2 virus. If the actual virus is introduced to your body, the antibodies recognize the spike protein and destroy it.
163When you hear family members, friends, or classmates that say that mRNA COVID vaccines will change your DNA you will know this is (False or True), because of what core concept in biology?
False because of central dogma. The viral mRNA introduced cannot modify your DNA.
164If you deleted the gene's promoter sequence from the DNA, what would happen at the mRNA level?
The transcription factors would not be able to recognize and bind to the DNA, so RNA polymerase wouldn't be able to attach, and mRNA would not be made.
In the DNA sequence below, the bolded A-T base pair is mutated to a C-G base pair (this means the top strand of DNA now reads ...ATGGAC...). Introns are underlined. Would this change affect the primary structure of the protein?
coding: 5' - ACTGAATCCTCGTATGGAAGCATATGACGGCTGACGTGTGGTATGC - 3'
165template: 3' - TGACTTAGGAGCATACCTTCGTATACTGCCGACTGCACACCATACG - 5'
Yes, the primary structure is defined as the sequence of amino acids in a protein. The normal sequence translated a Glu while the mutated one translated an Asp, since these are different amino acids the primary structure is different.
166Keeping in mind amino acid chemistry, which of the following best describes the effect the mutation described in the question above would have on the tertiary structure of the protein?
This mutation would likely only cause a small change, if any, in the tertiary structure of the protein. Both the original and the mutated amino acid have negatively charged R-groups, so their chemistry is similar and they would cause the tertiary structure to fold similarly.
167Translation is the process by which
:ribosomes synthesize protein from information in an mRNA molecule.
168Which statement best describes how DNA mutations impact the structure of proteins?
Mutations can alter the amino acid sequence, potentially affecting protein folding.
169If all of the cells in the human body have the same genetic information as one another (the entire human genome), why does a skin cell differ from a muscle cell?
Different cell types express different genes due to different transcription factors
170Chromatin is composed of ____________.
DNA and protein
171The lac operon in E. coli is a classic example of gene regulation in bacteria. When lactose is present in the environment, the lac operon is activated, allowing the bacteria to metabolize the sugar. Generally speaking, the regulation for prokaryotes is dependent on _________.
A repressor protein that binds to the operator and prevents transcription.
172If you made a change in the promoter sequence in the DNA that inactivates the promoter, what would happen at the RNA level?
The RNA polymerase would not be able to recognize and bind the DNA, so no RNA would be made.
173True or false: Both artificial and natural food products can be safe or unsafe.
True
174Which of the following best describes how the safety of vaccines is ensured during development and distribution?
Vaccines are tested through multiple phases of clinical trials to assess efficacy, effectiveness, and protection before receiving regulatory approval.
175If a DNA sequence mutated in such a way that the resulting protein was truncated (shortened), which mutation would be most likely?
nonsense
176Oligomycin is a toxin produced by a family of bacteria which inhibits ATP synthase. How could this impact metabolite levels during cellular respiration? Select all that apply.
Build up of NADH and FADH2
Lower levels of ATP
177ATP is a nucleic acid which powers the cell. How does it accomplish this?
By breaking off phosphate group, releasing energy.
178Actinomycin D is a toxin which disrupts bonds between guanine and cytosine in DNA molecules, disrupting the structure of DNA and blocking RNA polymerase from reading the template strand. Which phase of transcription would be disrupted by actinomycin D? (for extra practice, explain why.)
Elongation
179Chromatin assembly is an example of which type of regulation?
Eukaryotic regulation
180P53 is a protein involved with halting the cell cycle if cellular issues are detected. When DNA damage is detected the P53 protein is stabilized and activated. What type of regulation is this an example of?
Protein modification
181After P53 is modified and activated, it then binds to the promoter regions of DNA to signal production of genes that aid in DNA repair or DNA self-destruction. What level of regulation does P53 perform?
transcription
182What is the enzyme responsible for unwinding the DNA double helix during replication?
Helicase
183Okazaki fragments are formed during DNA replication on the
:lagging strand
184The phase of the cell cycle during which DNA replication occurs is
:S
185When do cells divide? (Mark all that apply.)
Growth
Repair
Reproduction
186DNA Polymerase III is responsible for encoding the new strand of DNA. Which direction does DNA Polymerase III read?
3' to 5'
187The _______ enzyme is responsible for synthesis of the majority of the new DNA strand during replication, while ________ is responsible for replacing the RNA primers with DNA nucleotides.
DNA polymerase III; DNA polymerase I
Which of the following sequences would result from the replication of the following DNA template?
1883'-AAGTCAGT-5
5'-TTCAGTCA-3'
Which enzyme is INCORRECTLY paired with its function?
DNA polymerase III - proofreads DNA base pairs
DNA helicase - unwinds DNA
DNA ligase - creates Okazaki fragments
Primase - catalyzes the synthesis of an RNA primer
189DNA polymerase I - Removes the RNA primer and replaces it with DNA
DNA ligase - creates Okazaki fragments
190The backbone of a DNA molecule is composed of
alternating sugar and phosphate.
191Complementary base pairs are held together by
:hydrogen bonds
192Benzoprenein cigarette smoke binds to DNA and distorts its shape, interfering with DNA replication. Which repair mechanism would most likely be used to repair the damage?
nucleotide excision repair
193Which stage of the cell cycle involves the actual period of cell division, including prophase, metaphase, anaphase, telophase, and cytokinesis?
M
194During which stage of mitosis do sister chromatids separate and migrate towards opposite ends of the cell?
Anaphase
195What is the difference between a sister chromatid and a homologous chromosome?
Sister chromatids are identical copies of each other, while homologous chromosomes can have different versions of the same gene.
196In humans, a normal body cell has 46 chromosomes. How many chromosomes would each daughter cell have after mitosis?
46
197How many chromosomes and chromatids are present during G1 of interphase for human somatic cells?
46;0
198How many chromosomes and chromatids are present during G2 of interphase for human somatic cells?
46;92
199How many chromosomes and chromatids are present after cytokinesis for human somatic cells?
46;0
200Where do microtubules connect to chromosomes to separate chromatids?
kinetochore
201What are the end products of mitosis?
2 genetically identical diploid cells
202What happens during the G2 phase of the cell cycle?
Cells grow and replicate organelles
203What is are sister chromatids?
Replicated chromosomes
204During crossing over in meiosis I ___________.
homologous chromosomes exchange genetic material
205During ____________ homologous pairs are pulled away from each other.
Anaphase I
206What is the significance of independent assortment in meiosis?
It increases genetic variation among offspring
207How does meiosis differ from mitosis?
Meiosis reduces the chromosome number by half, while mitosis maintains the chromosome number.
208How many chromosomes and chromatids are present during G1 of interphase for human germline cells?
46;0
209How many chromosomes and chromatids are present during G2 of interphase for human germline cells?
46;92
210How many chromosomes and chromatids are present after meiosis I in human germ-line cells?
23;46
211What are the end products of meiosis?
4 genetically unique haploid cells
212Why is sexual reproduction a beneficial strategy?
It increases genetic diversity within a population.
213Which of the following scenarios is an example of nondisjunction?
A homologous pair of chromosomes fails to separate during meiosis I.
Which strand is the LEADING strand?
A
\\ 5'
=====
//
215primase
synthesizes RNA primers
216DNA polymerase I
replaces RNA primers with DNA
217liagase
joins Okazaki fragments together
218helicase
breaks hydrogen bonds to separate strands of DNA
219topiosmerase
relieves tension in the DNA from unwinding
220SSBPs
stabilizes separated DNA strands to keep them from reattaching to each other
You are given 3 DNA samples and you are to determine which 2 samples contain the same genetic information. The only information that you have been given is one of the nucleotide concentrations in each sample.
Sample A: 20% Adenine
Sample B: 25% Thymine
Sample C: 25% Cytosine
221Based on this information, which 2 samples are the most likely candidates for containing the same genetic information, meaning they came from the same DNA?
B and C
222For the DNA sequence 5' ACT GCT AAG 3', the complementary DNA strand would be what (hint: read each option left to right and right to left)?
5' CTT AGC AGT 3'
223A new nucleotide can only be added to the ____ end of a growing DNA strand.
3'
224The fennec fox (Vulpes zerda) has 32 PAIRS of chromosomes in a somatic cell found in its ear for a total of 64 chromosomes. How many individual chromosomes would be found in the gametes of a fennec fox?
32
225Axolotls are critically endangered salamanders found in Mexico. They keep their gills through adulthood (and they are very cute). An Axolotl has 2n=28 chromosomes. If you looked at a cell in prophase of an Axolotl, you would find ________ chromosomes.
28
226An Axolotl has 2n=28 chromosomes. If you looked at a cell in prophase of an Axolotl, you would find ________ chromatids.
56
227Which of the following is a difference between mitosis and meiosis?
Cells produced by mitosis are diploid; cells produced by meiosis are haploid.
228Review: Cellular respiration harvests the most chemical energy from which of the following?
Oxidative phosphorylation
Review: You are working in a laboratory researching prokaryotes. You observe the structures listed below under the microscope and you realize that you are looking at a eukaryotic cell, not a prokaryotic one. Which structure did you use to make that conclusion?
Cell wall
Plasma membrane
Ribosomes
Endoplasmic Reticulum
229DNA
The presence of an endoplasmic reticulum
230Why does the lagging strand have to catch up continually?
DNA polymerase III only reads from 3'-5' and the lagging strand runs from 5' to 3'
231Which explanation best explains why telomerase isn't active in most somatic cells?
Unregulated telomerase activity can lead to uncontrolled cell division and cancer.
232Xeroderma pigmentosum (XP) is a genetic disorder that causes extreme sensitivity to sunlight and a high risk of skin cancer. The cells of individuals with this condition are unable to repair thymine dimers caused by UV radiation. Which DNA repair mechanism is most likely defective in this genetic disorder?
Nucleotide excision repair
233The ATR gene codes for a protein that checks that DNA has properly replicated. Which checkpoint does ATR play a role one?
G2 checkpoint
234The image above depicts which phase of mitosis? (cell in the middle of division. Two distinct groups of dark purple chromosomes are being pulled apart toward opposite sides of the cell. The rest of the cell appears lighter and translucent around them, showing that the sister chromatids have already split and are migrating to opposite poles.
Anaphase
235Refer to the figure below: in this cell, ______ are aligned, indicating this cell is in the _____ stage of .
Homologous pairs; metaphase I; meiosis
236At the end of which cell cycle stages is/are there diploid cells? (mark all that apply)
Mitosis
237Homologous chromosomes are....
not identical. They do carry information for the same traits. They have different versions of genes.
238Sister chromosomes are...
are identical. They do carry information for the same traits. They have the same versions of genes.
239A 40-year old pregnant woman undergoes prenatal testing, and her baby's karyotype reveals the presence of 1 X chromosome and 2 Y chromosomes. What cellular events could explain this, and which gametes contributed the sex chromosomes? *Hint - Draw it out!
Nondisjunction in the father during meiosis II, resulting in a sperm carrying two Y chromosomes, and the mother contributing one X chromosome.
240Which of the following best reflects the biological complexities of sex determination in humans and other animals?
Biological sex involves a range of factors including chromosomes, hormone levels, gonads, and anatomical structures, which do not always align in a strictly binary fashion.
241Mendel's experiments with pea plants revealed that traits in the F1 generation
:Mendel's experiments with pea plants revealed that traits in the F1 generation:
242How do the patterns of inheritance differ between codominance and incomplete dominance?
Codominance involves the expression of both alleles simultaneously, leading to a phenotype that exhibits traits from both alleles, whereas incomplete dominance results in a phenotype that is a combination of the traits from both alleles.
243In a monohybrid cross between two heterozygous individuals (Aa), what is the probability of their offspring having a phenotype corresponding to the recessive allele?
25%
244How is Mendel's law of segregation is reflected in the formation of gametes during meiosis?
Homologous chromosomes segregate independently during meiosis, contributing to the variety of gamete compositions.
245A species of chicken exhibits incomplete dominance. There are three phenotypes: black, gray, and white. If a white female and a gray male mate, what percentage of the offspring would be grey?
50%
246Having 6 fingers is an autosomal dominant trait to having 5 fingers. A 6-fingered man who had a mother with 6 fingers and his wife has 5 fingers but her father has 6. Based on the available information, is it possible for this man to have a daughter with 5 fingers.
Yes
247Your blood type is A+ and your oldest son is type O-. What does this tell us about your genotype and the genotype of your partner?
You and your partner must both have an O allele (blood type) and a - allele (Rh antigen)
248Marfan syndrome is caused by a variation in the FBN1 gene. People with Marfan syndrome tend to be tall with long thin fingers, toes, and limbs - impacting many parts of the body. Marfan syndrome is an example of __________.
pleiotropic genes
Huntington's disease is a serious genetic disorder that causes neurodegeneration and ultimately death, but symptoms typically appear only after age 30 and become very apparent before age 40. Huntington's disease is caused by an autosomal dominant allele (H). A separate gene is associated with the ability to see color. The red-green color blindness allele is X-linked recessive (b).
A man in his early thirties who has early stages of Huntington's disease and normal color vision. The man's father lived to age 85 and did not have Huntington's disease.
Based on this information the man must have the genotype _______ .
249*Note- Canvas was being difficult with the superscript, so pretend that any "B" or "b" following an X is in superscript.
HhXBY